You are currently viewing an outdated version of
SubtiWiki.
Please use
the newest version!
cdaA [2019-05-24 08:58:16]
diadenylate cyclase, synthesis of c-di-AMP in vegetative cells
Molecular weight
30.42 kDa
Function
synthesis of c-di-AMP
Product
diadenylate cyclase
Genomic Context
Categories containing this gene/protein
Gene
Coordinates
196,213 → 197,034
Phenotypes of a mutant
inactivation of cdaA results in severe beta-lactam sensitivity PubMeda cdaA disA double mutant or cdaA cdaS disA triple mutant is not viable on complex medium; however, the mutant grows at low potassium concentration (0.1 mM) PubMed The protein
Catalyzed reaction/ biological activity
synthesis of c-di-AMP from two molecules of ATP PubMed Paralogous protein(s)
Domains
Cofactors
Effectors of protein activity
the interaction with CdaR controls the diadenylate cyclase activity of CdaA PubMedthe interaction with CdaR inhibits the diadenylate cyclase activity of CdaA (shown in S. aureus) PubMed Structure
4RV7 (the DAC domain and C-terminal domain of CdaA from Listeria monocytogenes (aa 101 - 273), 65% identity) PubMed6HVL (the DAC domain and C-terminal domain of CdaA from Listeria monocytogenes (aa 101 - 273) in complex with c-di-AMP, 65% identity) PubMed Localization
Expression and Regulation
Operons
Additional information
CdaA levels are increased at increased potassium concentrations PubMedthe mRNA is very stable (> 15 min) PubMed Biological materials
Mutant
GP94 ΔcdaA::spec, available in Jörg Stülke's lab PubMedGP997 ΔcdaA::cat, available in Jörg Stülke's lab PubMedGP2790 ΔcdaA::aphA3, available in Jörg Stülke's labGP985 (cdaA-cdaR::cat), available in Jörg Stülke's labGP2222 (cdaA::cat cdaS::ermC disA::tet), available in Jörg Stülke's lab, the mutant is only viable on minimal medium at low potassium concentration PubMedBKE01750 (ΔcdaA::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATTTCCTCGTCCTCCAAGA, downstream forward: _UP4_CGCTGGTATTGGAGGGGCAABKK01750 (ΔcdaA::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATTTCCTCGTCCTCCAAGA, downstream forward: _UP4_CGCTGGTATTGGAGGGGCAA Expression vectors
expression of native cdaA in B. subtilis: pGP1960 (in pBQ200), available in Jörg Stülke's labexpression of cdaA-Strep in B. subtilis suitable for SPINE: pGP1986 (in pGP382), available in Jörg Stülke's labIPTG inducible expression of cdaA-Strep in E. coli: pGP2564 (in pGP574), available in Jörg Stülke's lab LacZ fusion
Two-hybrid system
B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Jörg Stülke's lab. Respective plasmid: pGP1990. FLAG-tag construct
References
Reviews
Loading
Original publications
Loading